Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_104820/circFAM120A/hsa_circ_0005218 | |||
Gene | FAM120A | Organism | Human |
Genome Locus | chr9:96233422-96259881:+ | Build | hg19 |
Disease | Pre- Eclampsia (PE) | ICD-10 | Pre-eclampsia (O14) |
DBLink | Link to database | PMID | 27606420 |
Experimental Method | |||
Sample Type | Placental Tissues | Comparison | 40 placental tissues from Pre-Eclampsia (PE) patients and 35 placental tissues from gestational age-matched patients who gave premature birth |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CCGTTGCTGACTATGTACGC ReverseTCATACGCAACCAAGCCATG | Statistics | Fold Change : Upregulated,5.96 pvalue : p<0.001 |
Citation | |||
Qian, Y, Lu, Y, Rui, C, Qian, Y, Cai, M, Jia, R (2016). Potential Significance of Circular RNA in Human Placental Tissue for Patients with Preeclampsia. Cell. Physiol. Biochem., 39, 4:1380-90. |